torsdag 14 februari 2008

För den som undrar...

...vad jag håller på med hela dagarna så kanske det här kan klargöra en del.

Det är den första medicin-vetenskapliga artikeln som jag är medförfattare till. I och för sig är jag endast andra namn men det är alltid nåt och bättre än ingenting alls. Fler artiklar lär ju dyka upp (eller måste dyka upp) under de 42 månaderna jag har kvar på min forskarutbildning.

Kolla gärna in den (pdf-format) och säg för guds skull till om ni inte hänger med.

6 kommentarer:

Anonym sa...

Jag kan inte öppna länken.

Pelaseyed sa...

Glömde bort att man inte kan kolla på sidorna om man befinner sig utanför universitetet. Nu har jag fixat länken så att man direkt kommer till PDF:en.

Ali Esbati sa...

Coolt som fan. Men det går inte läsa artikeln om man inte är polise makhfi.

Ali Esbati sa...

Aha. Nu gick det. Men mitt rättsstavningsprogram reagerar negativt på det här ordet:

5-GATCCGTGTACAACACCTTCCAGCCTTCCCTAAACCACATAAACCCAGAAAGAAAGATCCAGATTCAGAGGCCCCAGGTAGTCATGACATCGTTGTAAG–
5-AATTCTTACAACGATGTCATGACTACCTGGGGCCTCTGAATCTGGATCTTTCTTTCTGGGTTTATGTGGTTTAGGGAAGGCTGGAAGGTGTTGTACACG

Anonym sa...

Thaher!

Kan du blogga om detta på UV:s blogg? Det är jätteviktigt!!!


http://www.aftonbladet.se/nyheter/article1844366.ab

pia sa...

Hej,

ordet "klargöra" var kanske inte helt vad dendär artikeln gjorde... men det ser ambitiöst ut! lycka till!